SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


intracellular proteinase inhibitor
13.93 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
control of intracellular proteolysis
intracellular proteinase inhibitor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Additional proteins involved in proteolysis]
  • Gene

    1,189,646 → 1,190,005

    The protein


  • [PDB|3ISY]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab


    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • BKE11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT, downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
  • BKK11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT, downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
  • References

  • 8226659,22585087,24555072,26577401,27965289