SubtiBank SubtiBank
ipi
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ipi

intracellular proteinase inhibitor
locus
BSU_11130
pI
4.69
mw
13.93 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
control of intracellular proteolysis
product
intracellular proteinase inhibitor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.4|Additional proteins involved in proteolysis]
  • Gene

    Coordinates
    1,189,646 → 1,190,005

    The protein

    Structure

  • [PDB|3ISY]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]
    description
    [Pubmed|8226659]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    genes
    [gene|07ABC6A548F1186B67B58C0E14915AC3FE94882E|yitT]-[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]
    description
    [Pubmed|27965289]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • BKE11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT, downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
  • BKK11130 (Δ[gene|D5536B27AFF8ADE7FAEA9B815F2607FC33B66404|ipi]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGCCTGATACCTCCT, downstream forward: _UP4_TAAGAGGCTATGGCGAGTCG
  • References

  • 8226659,22585087,24555072,26577401,27965289