SubtiBank SubtiBank
yqxG

yqxG

similar to phage-related lytic exoenzyme
locus
BSU_25920
pI
5.84
mw
32.39 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdC

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,665,903 → 2,666,796

    Biological materials

    Mutant

  • BKE25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • BKK25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT