SubtiBank SubtiBank
yqxG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxG

similar to phage-related lytic exoenzyme
locus
BSU25920
pI
5.84
mw
32.39 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdC

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,665,903 → 2,666,796

    Biological materials

    Mutant

  • BKE25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • BKK25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT