SubtiBank SubtiBank
yqxG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yqxG

similar to phage-related lytic exoenzyme
locus
BSU_25920
pI
5.84
mw
32.39 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdC

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,665,903 → 2,666,796

    The protein

    Paralogous protein(s)

  • [protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA]
  • [protein|4F4F48730C97FBEEEAE6B4080D2DD324C575633E|YomS]: 33% identity to the C-terminal part of [protein|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|YqxG]
  • Structure

  • [PDB|6IA5] ([protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA], 56% identity) [pubmed|31692476]
  • Biological materials

    Mutant

  • BKE25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • BKK25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • References

    Research papers

  • 31692476