SubtiBank SubtiBank
yqxG
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yqxG

similar to phage-related lytic exoenzyme
locus
BSU_25920
pI
5.84
mw
32.39 kDa
protein length
297 aa Sequence Blast
gene length
894 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdC

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,665,903 → 2,666,796

    The protein

    Paralogous protein(s)

  • [protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA]
  • [protein|4F4F48730C97FBEEEAE6B4080D2DD324C575633E|YomS]: 33% identity to the C-terminal part of [protein|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|YqxG]
  • Structure

  • [PDB|6IA5] ([protein|27BB6659541BA5368DEDB19EADCD372CE41244F5|XepA], 56% identity) [pubmed|31692476]
  • Biological materials

    Mutant

  • BKE25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • BKK25920 (Δ[gene|D55168C206F2B6B79F9F8FCA90A757F6CCE39849|yqxG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25920 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTATAAATCCTCCTTGCT, downstream forward: _UP4_TAAGATCCGGCTGTCCTTTT
  • References

    Research papers

  • 31692476