SubtiBank SubtiBank
walJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

walJ

5'-3' double-stranded DNA exonuclease, coordination of cell division with DNA replication
locus
BSU_40370
pI
5.50
mw
29.77 kDa
protein length
264 aa Sequence Blast
gene length
795 bp Sequence Blast
function
coordination of cell division with DNA replication
product
5'-3' double-stranded DNA exonuclease
essential
no
ec
3.-.-.-
synonyms
yycJ

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.1|Biosynthesis of peptidoglycan]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.7|Mismatch repair (MMR)]
  • Gene

    Coordinates
    4,148,851 → 4,149,645

    Phenotypes of a mutant

  • the mutant divides over unsegregated chromosomes more frequently than wild-type cells, and this phenotype is exacerbated when DNA replication is inhibited [Pubmed|21169496]
  • increased sensitivity to a narrow spectrum of cephalosporin antibiotics [Pubmed|21169496]
  • disruption of the corresponding gene in B. anthracis results in a mutator phenotype [Pubmed|21205011]
  • The protein

    Catalyzed reaction/ biological activity

  • 5'-3' exonuclease activity at the 5' termini and at nicks of double-stranded DNA [Pubmed|23491602]
  • the enzymatic activity of WalJ directly or indirectly affects cell wall metabolism and is required for accurate coordination of [SW|cell division] with DNA replication [Pubmed|21169496]
  • Protein family

  • predicted member of the metallo-β-lactamase superfamily
  • [SW|Cofactors]

  • Mn(II) [Pubmed|23491602]
  • Expression and Regulation

    Operons

    genes
    [gene|7F340423A34CE40D1F1AA8D373F7C4B859A6496D|walR]-[gene|E88978809272FAC2520DB4ABCA0554F8028F3451|walK]-[gene|06D2D03C65D50E3909B2C93835193815B6016967|walH]-[gene|EE681C9A42FCC29CBB55CC9566EE4CFF986D0F1D|walI]-[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]-[gene|75B8C37E589C855D2BAD7FB51B9600E161ACFBD3|htrC]
    description
    [Pubmed|9829949]

    regulation

  • ''htrC'' transcript expressed during sporulation [Pubmed|9829949]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B824 (yycJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1823 NBRP B. subtilis, Japan]
  • 1A1044 ( ''walJ''::''spec''), [Pubmed|21169496], available at [BGhttp://bgsc.org/getdetail.php?bgscid=1A1044]
  • BKE40370 (Δ[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACTCCATT, downstream forward: _UP4_TAATTTTTCTATGTAAATCA
  • BKK40370 (Δ[gene|D5321F707E183E72B225F1CED2F2FDCB1183B88A|walJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGTCTCACTCCATT, downstream forward: _UP4_TAATTTTTCTATGTAAATCA
  • References

    Reviews

  • 26343983
  • Original publications

  • 9829949,21169496,21205011,23491602