SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


protein kinase, required for the assembly of several outer coat proteins
42.65 kDa
protein length
362 aa Sequence Blast
gene length
1089 bp Sequence Blast
protection of [protein|EB690FA075EAC3E298C47AED082B5FC21E8F8F46|CotU] and [protein|9C59B51FC19FC83BD14272008BD441833DD1738E|CotC] in the mother cell
protein kinase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Not yet assigned]
  • Gene

    3,716,009 → 3,717,097

    Phenotypes of a mutant

  • overexpression of ''cotH'' suppresses the phenotypes of a [gene|825AD8D4315A85CD384F9AF6AD894E38E57C88F7|cotE] mutant [Pubmed|24086406]
  • reduced [SW|germination] efficiency [Pubmed|27185916]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation with ATP and subsequent phosphorylation of [protein|2A0B2CA7C982C03C1AFBDB3540A918EE937B06CB|CotB] and [protein|49BAFE3E69F1F91AEF4154F55B44639DD3CE4A71|CotG] on serine residues [Pubmed|32592201,27185916]
  • Protein family

  • cotH family (with [protein|75FBA935A39AF67DB4E69C8699D29D9F5C149143|YisJ], according to UniProt)
  • [SW|Cofactors]

  • Mn2+ [Pubmed|27185916]
  • Structure

  • [PDB|5JD9] [Pubmed|27185916]
  • [SW|Localization]

  • inner spore coat
  • Expression and Regulation



    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15699190,8755863,1691789,12480901], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15383836], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR]: activation, [Pubmed|20435725], in [regulon|0D7F5504590512E1598B94DC1734BF8FF67ED994|GerR regulon]
  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: repression, [Pubmed|15470121], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: activation, [Pubmed|26577401], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • expressed late during sporulation in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE], [SW|SpoIIID]) [Pubmed|26577401,15699190,8755863,15470121]
  • view in new tab

    Biological materials


  • BKE36060 (Δ[gene|D53067098F693669F61E5CCF6C06664580C40C79|cotH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATAATCCTCCTTACA, downstream forward: _UP4_TGAATGCGTGAAAATGGGTA
  • BKK36060 (Δ[gene|D53067098F693669F61E5CCF6C06664580C40C79|cotH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATAATCCTCCTTACA, downstream forward: _UP4_TGAATGCGTGAAAATGGGTA
  • References


  • 27227299
  • Original Publications

  • 10198031,15699190,8755863,15470121,18065538,24086406,21984783,25259857,25115591,26484546,26953338,27185916,14762006,26577401,28870294,31713316,32592201