SubtiBank SubtiBank
ydbO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydbO

similar to cation efflux system
locus
BSU_04540
pI
6.23
mw
31.33 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    506,866 → 507,738

    The protein

    Protein family

  • [SW|Cation diffusion facilitator (CDF) transporter (TC 2.A.4) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|72BF9B934CB5800E156263FF377DED0AD2E920A9|MneS], [protein|28C7CFE5701F6920652BE1973DC7A15D7C088E35|MneP]
  • Structure

  • [PDB|5VRF] (from Shewanella oneidensis, 26% identity) [pubmed|29507252]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C120 (ydbO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2118 NBRP B. subtilis, Japan]
  • BKE04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT, downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
  • BKK04540 (Δ[gene|D52111E81E9233DABAEFCAF6217145CF6A7F3961|ydbO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGAATACCAGCCTCCAT, downstream forward: _UP4_ATAAAATAAGGCTGTTTAAC
  • References

    Research papers

  • 29507252