SubtiBank SubtiBank
pheA [2018-12-03 16:18:29]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pheA [2018-12-03 16:18:29]

prephenate dehydratase
31.75 kDa
protein length
285 aa Sequence Blast
gene length
855 bp Sequence Blast
biosynthesis of phenylalanine
prephenate dehydratase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    2,851,283 → 2,852,140

    The protein

    Catalyzed reaction/ biological activity

  • Prephenate = phenylpyruvate + H2O + CO2 (according to Swiss-Prot)
  • Effectors of protein activity

  • subject to feedback inhibtion by phenylalanine [Pubmed|4956345]
  • Structure

  • [PDB|4LUB] (from ''Streptococcus mutans'', 42% identity)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2537815], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • additional information

  • expression is repressed by binding of [SW|RpoE] to the A-rich sequence in the -35 region of the promoter [Pubmed|27679485]
  • view in new tab

    Biological materials


  • 1A617 ( ''pheA''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT, downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
  • BKK27900 (Δ[gene|D4CCF6727AAC048792E59717E588C36EB617249D|pheA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GACTTTCATGACGATTTTCT, downstream forward: _UP4_TAAAAAAAGCCCACTAGAGG
  • References

  • 19258532,2537815,4956345