SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK])
40.69 kDa
protein length
375 aa Sequence Blast
gene length
1128 bp Sequence Blast
protein quality control
heat-shock protein (activation of [protein|30E0AAABB803E577D0D9FBAEF9031319CABD3D89|DnaK])

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.2|Chaperones/ protein folding]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.4|Heat shock proteins]
  • Gene

    2,624,785 → 2,625,912

    The protein

    Protein family

  • dnaJ family (single member, according to UniProt)
  • [SW|Domains]

  • J domain (aa 5-69) (according to UniProt)
  • Structure

  • [PDB|3LZ8] (from ''Klebsiella pneumoniae'', 34% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1339421], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA]: repression, [Pubmed|1339421], in [regulon|2E57DFB4162EF0CE759C1FC42C637E1B9E4B2F7E|HrcA regulon]
  • regulation

  • induced by heat shock ([protein|search|HrcA]) [Pubmed|1339421]
  • view in new tab

    Biological materials


  • BKE25460 (Δ[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTCACTCTCCCG, downstream forward: _UP4_TAATTATTGGATGAGGAGTT
  • BKK25460 (Δ[gene|D4C75B39B2DAECB9D85DAD66AAD4F923C9AEBEA7|dnaJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCGCTTCACTCTCCCG, downstream forward: _UP4_TAATTATTGGATGAGGAGTT
  • labs

  • [SW|Wolfgang Schumann], Bayreuth University, Germany [ Homepage]
  • References

  • 10383760,9023197,1339421,7592421