SubtiBank SubtiBank
qcrA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

qcrA

Rieske factor, menaquinol:cytochrome c oxidoreductase (iron-sulfur subunit), component of the cytochrome bc1 complex
locus
BSU_22560
pI
6.08
mw
18.59 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
respiration
product
menaquinol:cytochrome c oxidoreductase (iron-sulfur subunit)
essential
no
synonyms
bfcA,petC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,364,589 → 2,365,092

    Phenotypes of a mutant

  • severe growth defect [pubmed|31420537]
  • The protein

    [SW|Domains]

  • Rieske domain (aa 59-158) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2ZT9] (from Nostoc sp., 31% identity) [pubmed|19189962]
  • [SW|Localization]

  • cell membrane [Pubmed|23880299]
  • delivered to the membrane by the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] [SW|protein secretion] system, this depends on prior dusulfide bond formation and co-factor insertion [Pubmed|24652282,23256564]
  • Expression and Regulation

    Operons

    genes
    [gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]-[gene|1DC5C6DAF0AB1EB59BC9361DC1161E75F99AFE33|qcrB]-[gene|F2973C512AFB4B9F8FE0CCAF09646E60F886C013|qcrC]
    description
    [Pubmed|7592464]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7592464], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|8631715], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by oxygen limitation ([protein|search|ResD]) [Pubmed|8631715]
  • view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials

    Mutant

  • BKE22560 (Δ[gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCTCCCCCCTCTA, downstream forward: _UP4_GCAAAGCCTAAGGGGGAAGG
  • BKK22560 (Δ[gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCTCCCCCCTCTA, downstream forward: _UP4_GCAAAGCCTAAGGGGGAAGG
  • References

    Reviews

  • 24140208
  • Original publications

  • 8631715,7592464,23880299,12850135,12107147,20817675,23256564,24652282,26239117,27503613,19189962,31420537