SubtiBank SubtiBank
qcrA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

qcrA

Rieske factor, menaquinol:cytochrome c oxidoreductase (iron-sulfur subunit), component of the cytochrome bc1 complex
locus
BSU_22560
pI
6.08
mw
18.59 kDa
protein length
167 aa Sequence Blast
gene length
504 bp Sequence Blast
function
respiration
product
menaquinol:cytochrome c oxidoreductase (iron-sulfur subunit)
essential
no
synonyms
bfcA,petC

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,364,589 → 2,365,092

    Phenotypes of a mutant

  • severe growth defect [pubmed|31420537]
  • The protein

    [SW|Domains]

  • Rieske domain (aa 59-158) (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • Structure

  • [PDB|2ZT9] (from Nostoc sp., 31% identity) [pubmed|19189962]
  • [SW|Localization]

  • cell membrane [Pubmed|23880299]
  • delivered to the membrane by the [protein|780FDF3DD260287428B397FFE7F44DDF1917381C|TatAY]-[protein|E60FC9C9B273DD6B07B7B95819525DE5F35113CE|TatCY] [SW|protein secretion] system, this depends on prior dusulfide bond formation and co-factor insertion [Pubmed|24652282,23256564]
  • Expression and Regulation

    Operons

    genes
    [gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]-[gene|1DC5C6DAF0AB1EB59BC9361DC1161E75F99AFE33|qcrB]-[gene|F2973C512AFB4B9F8FE0CCAF09646E60F886C013|qcrC]
    description
    [Pubmed|7592464]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7592464], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|8631715], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by oxygen limitation ([protein|search|ResD]) [Pubmed|8631715]
  • view in new tab

    additional information

  • highly expressed at high iron concentrations [pubmed|31420537]
  • Biological materials

    Mutant

  • BKE22560 (Δ[gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCTCCCCCCTCTA, downstream forward: _UP4_GCAAAGCCTAAGGGGGAAGG
  • BKK22560 (Δ[gene|D4AF96C936093BA44E46FF92A3EDE437495B0923|qcrA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCTCCCCCCTCTA, downstream forward: _UP4_GCAAAGCCTAAGGGGGAAGG
  • References

    Reviews

  • 24140208
  • Original publications

  • 8631715,7592464,23880299,12850135,12107147,20817675,23256564,24652282,26239117,27503613,19189962,31420537