SubtiBank SubtiBank
yfhC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhC

unknown
locus
BSU_08480
pI
9.16
mw
22.31 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    923,587 → 924,171

    The protein

    Protein family

  • [SW|nitroreductase family] (according to UniProt)
  • Structure

  • [PDB|2I7H] (from B. cereus, 34% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|27B76EFFD5F45E412BD98C67EFD9F1DEC548C00B|yfhB]-[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]
    description
    [pubmed|22383849]
    view in new tab

    genes
    [gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|12354229], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C358 (yfhC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2356 NBRP B. subtilis, Japan]
  • BKE08480 (Δ[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGTCTCACCTTCCTA, downstream forward: _UP4_TAAAAAACCCCTTGTCTCAA
  • BKK08480 (Δ[gene|D47DD451B140132087AC7A68207C202A37A1F291|yfhC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACCGTCTCACCTTCCTA, downstream forward: _UP4_TAAAAAACCCCTTGTCTCAA
  • References

  • 12354229