SubtiBank SubtiBank
yvgM [2018-12-18 17:47:27]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvgM [2018-12-18 17:47:27]

similar to ABC transporter for molybdenum uptake (permease)
locus
BSU33390
pI
7.91
mw
20.10 kDa
protein length
186 aa Sequence Blast
gene length
558 bp Sequence Blast
function
unknown
product
ABC transporter (permease)
essential
no
synonyms
yvsC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.4|Trace metals/ Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,426,035 → 3,426,718

    Expression and Regulation

    Operons

    genes
    [gene|7DCC368C52FB0DA12D807919CFEB49E2625932D3|yvgL]-[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B062 (yvgM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1061 NBRP B. subtilis, Japan]
  • BKE33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • BKK33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • References

  • 10092453