SubtiBank SubtiBank
yvgM [2018-12-18 17:55:07]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yvgM [2018-12-18 17:55:07]

similar to [SW|ABC transporter] for molybdenum uptake (permease)
20.10 kDa
protein length
186 aa Sequence Blast
gene length
558 bp Sequence Blast
[SW|ABC transporter] (permease)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Trace metals/ Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,426,035 → 3,426,718

    The protein

    Protein family

  • [SW|CysTW subfamily] (according to UniProt)
  • Structure

  • [PDB|2ONK] (33% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B062 (yvgM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • BKK33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • References

  • 10092453