SubtiBank SubtiBank
yvgM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvgM

similar to [SW|ABC transporter] for molybdenum uptake (permease)
locus
BSU_33390
pI
7.91
mw
20.10 kDa
protein length
227 aa Sequence Blast
gene length
684 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (permease)
essential
no
synonyms
yvsC

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.4|Trace metals/ Other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,426,035 → 3,426,718

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|CysTW subfamily] (according to UniProt)
  • Structure

  • [PDB|2ONK] (from Archaeoglobus fulgidus, 33% identity) [pubmed|17322901]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|7DCC368C52FB0DA12D807919CFEB49E2625932D3|yvgL]-[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B062 (yvgM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1061 NBRP B. subtilis, Japan]
  • BKE33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • BKK33390 (Δ[gene|D45E06B22749CD1127C07152515F5EF795B420FF|yvgM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTGAAAAATTCTGAAGCGC, downstream forward: _UP4_TAAAAAAACTCCCCATAACG
  • References

  • 10092453,17322901