SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


D-glutamyl-L-amino acid peptidase
32.91 kDa
protein length
296 aa Sequence Blast
gene length
891 bp Sequence Blast
cell wall metabolism
D-glutamyl-L-amino acid peptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.5|Cell wall/ other]
  • Gene

    1,367,941 → 1,368,831

    The protein

    Catalyzed reaction/ biological activity

  • cleaves L-Ala-γ-D-Glu dipeptides from cell wall peptides [Pubmed|20944232]
  • The enzyme releases L-Ala-gamma-D-Glu dipeptides from cell wall peptides via cleavage of an L-Ala-gamma-D-Glu-|-L-Lys bond (according to UniProt)
  • Protein family

  • [SW|Peptidase C40 family] (according to UniProt)
  • Structure

  • [PDB|3H41] (from B. cereus, 39% identity) [pubmed|20944232]
  • Expression and Regulation



    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • view in new tab

    Biological materials


  • MGNA-A742 (ykfC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12990 (Δ[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTGATATGACAGTGT, downstream forward: _UP4_TTTTCAGAATAAGGAGGGAG
  • BKK12990 (Δ[gene|D40ECAE51D9E4791C6FAAA25E2E0D0591D9FAA55|ykfC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTGCTGATATGACAGTGT, downstream forward: _UP4_TTTTCAGAATAAGGAGGGAG
  • References

  • 12618455,20944232