SubtiBank SubtiBank
yrrO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yrrO

tRNA uridine hydroxylase (in complex with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN])
locus
BSU_27340
pI
4.85
mw
47.46 kDa
protein length
422 aa Sequence Blast
gene length
1269 bp Sequence Blast
function
introduction of 5-methoxyuridine modification in tRNA (U34)
product
tRNA uridine hydroxylase
essential
no
synonyms
trhP2

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    2,792,860 → 2,794,128

    Phenotypes of a mutant

  • 50% reduction in mo5U tRNA levels [pubmed|31358606]
  • The protein

    Catalyzed reaction/ biological activity

  • hydroxylation of U34 in tRNA to give 5-hydroxyuridine (ho5U) (in complex with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN]) with prephenate as hydroxyl donor, ho5U is the precursor for 5-methoxyuridine modification (by [protein|CE4F2965077F2A5882432D683520E09B70B9369A|TrmR]) [pubmed|31358606]
  • Protein family

  • peptidase U32 family (with [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN], according to UniProt)
  • Paralogous protein(s)

  • [protein|A3EC327DA14F188E88AF4221B51EE5950F882277|YrrN]
  • Expression and Regulation

    Operons

    genes
    [gene|CE4F2965077F2A5882432D683520E09B70B9369A|trmR]-[gene|A3EC327DA14F188E88AF4221B51EE5950F882277|yrrN]-[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]-[gene|A659D9894E777D8A99707CB750DF2918AEE06CE9|udk]-[gene|6FBF27C12B4B3DC2CE373E5199357042114471F8|greA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A007 (yrrO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/7 NBRP B. subtilis, Japan]
  • BKE27340 (Δ[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG, downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA
  • BKK27340 (Δ[gene|D4046AA4C4ACB6A0A2F2020CA1E659F65CAFE68D|yrrO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27340 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAGCTTAACCTCCTTTTG, downstream forward: _UP4_ATGAGAAAGGGGAAGTAACA
  • References

    Research papers

  • 31358606