SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to restriction-modification enzyme
100.96 kDa
protein length
879 aa Sequence Blast
gene length
2640 bp Sequence Blast
putative restriction-modification enzyme

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • Gene

    740,288 → 742,927

    The protein


  • [PDB|5HR4] (from Methylophilus methylotrophus, 38% identity) [pubmed|27082731]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A959 (yeeA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06760 (Δ[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTTTCCCCCATTAA, downstream forward: _UP4_ACAGAACGGTAGGTGTAAGG
  • BKK06760 (Δ[gene|D3F00747006D974A8635D4391E0C261A3276E6AB|yeeA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCGTTTCCCCCATTAA, downstream forward: _UP4_ACAGAACGGTAGGTGTAAGG
  • References

    Research papers

  • 27082731