SubtiBank SubtiBank
albB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

albB

antilisterial bacteriocin (subtilosin) production
locus
BSU37380
pI
10.83
mw
5.98 kDa
protein length
gene length
162 bp Sequence Blast
function
antilisterial bacteriocin (subtilosin) production
product
unknown
essential
no
synonyms
ywhR

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,837,682 → 3,837,843

    The protein

    [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • BKE37380 (Δ[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTGGTGACAAATCGTTTC, downstream forward: _UP4_CGCGCGCGGAAGGCTGACTC
  • BKK37380 (Δ[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTGGTGACAAATCGTTTC, downstream forward: _UP4_CGCGCGCGGAAGGCTGACTC
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793,19633086