SubtiBank SubtiBank
polX
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

polX

DNA polymerase X, involved in DNA repair, generates adaptive mutations by error-prone processing of A/P sites
locus
BSU_28590
pI
5.31
mw
63.95 kDa
protein length
570 aa Sequence Blast
gene length
1713 bp Sequence Blast
function
DNA repair
product
DNA polymerase X
essential
no
ec
2.7.7.7
synonyms
yshC

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
  • Gene

    Coordinates
    2,923,314 → 2,925,026

    The protein

    Catalyzed reaction/ biological activity

  • template-dependent DNA polymerase, fills single nucleotide gaps [Pubmed|18938175]
  • has intrinsic 3'-5' exonuclease activity for resecting unannealed 3'-termini in gapped DNA substrates [Pubmed|18776221]
  • has intrinsic apurinic/apyrimidinic (AP) endonuclease activity [Pubmed|20974932]
  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • Protein family

  • N-terminal part: DNA polymerase type-X family (single member, according to UniProt)
  • C-terminal part: PHP family (single member, according to UniProt)
  • [SW|Domains]

  • C-terminal PHP domain with an active site formed by nine histidines and aspartates that catalyzes 3'-5' exonuclease, AP-endonuclease, 3'-phosphodiesterase and 3'-phosphatase activities [pubmed|31289311]
  • Structure

  • [PDB|3AU2] (from Thermus thermophilus, complex with dGTP, 37% identity) [pubmed|22306405]
  • Expression and Regulation

    Operons

    genes
    [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]-[gene|93726C423313C653C4F71CB107FA12F686959E41|yshB]-[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]-[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB]-[gene|18CEF3F1EE2E95A009699DE370CBB44F025B7B40|yshE]
    description
    [Pubmed|22383849]

    regulation

  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials

    Mutant

  • GP3560 (Δ([gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]-[gene|F8E82D9AE514B31892FE4530532691274ADA682B|mutSB])::kan), available in [SW|Jörg Stülke]'s lab
  • MGNA-B003 (yshC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1002 NBRP B. subtilis, Japan]
  • BKE28590 (Δ[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACA
  • BKK28590 (Δ[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACA
  • labs

  • [SW|Margarita Salas], Madrid, Spain [http://www.cbm.uam.es/mkfactory.esdomain/webs/CBMSO/plt_LineasInvestigacion.aspx?IdObjeto=28 link]
  • References

    Reviews

  • 22933559
  • Original publications

  • 20974932,18938175,18776221,22844091,24914186,28254425,22306405,31289311