SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


DNA polymerase X, involved in DNA repair, generates adaptive mutations by error-prone processing of A/P sites
63.95 kDa
protein length
570 aa Sequence Blast
gene length
1713 bp Sequence Blast
DNA repair
DNA polymerase X

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,923,314 → 2,925,026

    The protein

    Catalyzed reaction/ biological activity

  • template-dependent DNA polymerase, fills single nucleotide gaps [Pubmed|18938175]
  • has intrinsic 3'-5' exonuclease activity for resecting unannealed 3'-termini in gapped DNA substrates [Pubmed|18776221]
  • has intrinsic apurinic/apyrimidinic (AP) endonuclease activity [Pubmed|20974932]
  • 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) --> diphosphate + DNA(n+1) (according to UniProt)
  • Protein family

  • N-terminal part: DNA polymerase type-X family (single member, according to UniProt)
  • C-terminal part: PHP family (single member, according to UniProt)
  • [SW|Domains]

  • C-terminal PHP domain with an active site formed by nine histidines and aspartates that catalyzes 3'-5' exonuclease, AP-endonuclease, 3'-phosphodiesterase and 3'-phosphatase activities [pubmed|31289311]
  • Structure

  • [PDB|3AU2] (from Thermus thermophilus, complex with dGTP, 37% identity) [pubmed|22306405]
  • Expression and Regulation




  • constitutively expressed [Pubmed|23701187]
  • view in new tab

    Biological materials


  • MGNA-B003 (yshC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28590 (Δ[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACA
  • BKK28590 (Δ[gene|D3954F2BCF6CE66505E4F48FCB4A61EE8D24F6D3|polX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATAACCCCCAGACG, downstream forward: _UP4_TAAGTAAGGAGGCTCACACA
  • labs

  • [SW|Margarita Salas], Madrid, Spain [ link]
  • References


  • 22933559
  • Original publications

  • 20974932,18938175,18776221,22844091,24914186,28254425,22306405,31289311