SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


component of the BsuM DNA restriction system
54.17 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
BsuM DNA restriction

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.4|DNA restriction/ modification]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • Gene

    661,630 → 663,027

    The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage of DNA to give specific double-stranded fragments with terminal 5'-phosphates (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C209 (ydjA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06110 (Δ[gene|D36B91B3C8EAFEB80A7395C62A50A5F80B8CC5C5|ydjA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACTTACTTGACTTATCCA, downstream forward: _UP4_TAGTTCTAGAAGGTTAAAAG
  • BKK06110 (Δ[gene|D36B91B3C8EAFEB80A7395C62A50A5F80B8CC5C5|ydjA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAACTTACTTGACTTATCCA, downstream forward: _UP4_TAGTTCTAGAAGGTTAAAAG
  • References

  • 11751814,22092861