SubtiBank SubtiBank
gtaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gtaB

UTP-glucose-1-phosphate uridylyltransferase, general stress protein
locus
BSU_35670
pI
4.91
mw
32.92 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
biosynthesis of teichoic acid
product
UTP-glucose-1-phosphate uridylyltransferase
essential
no
ec
2.7.7.9
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,665,629 → 3,666,507

    Phenotypes of a mutant

  • cells are bent and distended due to the lack of glucolipids [Pubmed|27684739]
  • the inactivation of ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'' suppresses the poor and filametous growth of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant [Pubmed|24097947]
  • inactivation of ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller, wider mother cells with small forespores [Pubmed|26735940]
  • resistant to phage SPO1 [pubmed|30811056]
  • The protein

    Catalyzed reaction/ biological activity

  • α-D-glucose 1-phosphate + H+ + UTP --> diphosphate + UDP-α-D-glucose (according to UniProt)
  • Protein family

  • UDPGP type 2 family (with [protein|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|YngB] and [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA], according to UniProt)
  • Paralogous protein(s)

  • [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA], [protein|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|YngB]
  • Modification

  • phosphorylated on Arg-76 [Pubmed|22517742]
  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|2E3D] (from ''E. coli'', 44% identity, 61% similarity) [Pubmed|17322528]
  • Expression and Regulation

    Operons

    genes
    [gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]
    description
    [Pubmed|8320212]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8320212], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8320212,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8320212,11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE35670 (Δ[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • BKK35670 (Δ[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • References

  • 8320212,2846750,22517742,16493705,11544224,24097947,26735940,27684739,30265683,30811056