SubtiBank SubtiBank
gtaB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gtaB

UTP-glucose-1-phosphate uridylyltransferase, general stress protein
locus
BSU35670
pI
4.91
mw
32.92 kDa
protein length
292 aa Sequence Blast
gene length
879 bp Sequence Blast
function
biosynthesis of teichoic acid
product
UTP-glucose-1-phosphate uridylyltransferase
essential
no
ec
2.7.7.9
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW 1.1.1.4|Biosynthesis of teichoic acid]
  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.3|Lipid metabolism/ other]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.1|Biosynthesis of cell wall components] → [category|SW 2.6.1.3|Biosynthesis of teichoic acid]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    3,665,629 → 3,666,507

    Phenotypes of a mutant

  • cells are bent and distended due to the lack of glucolipids [Pubmed|27684739]
  • the inactivation of ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'' suppresses the poor and filametous growth of the ''[gene|1986DB3078FBA16D6ACCD70EEAC95C46564D0958|whiA] [gene|EAD44AA7D72510B70308FD0C9F159DBEDAEBBB74|zapA]'' double mutant [Pubmed|24097947]
  • inactivation of ''[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]'' reduces sporulation efficiency to 0.1% that of wild type cells; smaller, wider mother cells with small forespores [Pubmed|26735940]
  • resistant to phage SPO1 [pubmed|30811056]
  • The protein

    Catalyzed reaction/ biological activity

  • UTP + alpha-D-glucose 1-phosphate = diphosphate + UDP-glucose (according to Swiss-Prot)
  • Protein family

  • UDPGP type 2 family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|FC455B727F66632D94D93E103B30748944ED04A0|YtdA], [protein|69C5D9EF7ED43BCAB7A9D6148EDD323CE72F8E3D|YngB]
  • Modification

  • phosphorylated on Arg-76 [Pubmed|22517742]
  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|2E3D] (from ''E. coli'', 44% identity, 61% similarity) [Pubmed|17322528]
  • Expression and Regulation

    Operons

    genes
    [gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]
    description
    [Pubmed|8320212]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8320212], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|8320212,11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|8320212,11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE35670 (Δ[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • BKK35670 (Δ[gene|D368988F85D8436DD424B0B4A1591BDF092A8EA7|gtaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGGCACCTTCCT, downstream forward: _UP4_TAAACAAAAAGGCTATTGGA
  • References

  • 8320212,2846750,22517742,16493705,11544224,24097947,26735940,27684739,30265683,30811056