SubtiBank SubtiBank
purL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

purL

phosphoribosylformylglycinamidine synthase
locus
BSU06480
pI
4.55
mw
80.10 kDa
protein length
742 aa Sequence Blast
gene length
2229 bp Sequence Blast
function
purine biosynthesis
product
phosphoribosylformylglycinamidine synthase
essential
no
ec
6.3.5.3
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.1|Biosynthesis/ acquisition of purine nucleotides]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    703,237 → 705,465

    The protein

    Catalyzed reaction/ biological activity

  • ATP N(2)-formyl-N(1)-(5-phospho-D-ribosyl)glycinamide L-glutamine H2O = ADP phosphate 2-(formamido)-N(1)-(5-phospho-D-ribosyl)acetamidine L-glutamate (according to Swiss-Prot)
  • Protein family

  • FGAMS family (according to Swiss-Prot)
  • Structure

  • [PDB|3D54] (from ''Thermotoga maritima'', 39% identity, 58% similarity) [Pubmed|18597481]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • membrane associated [Pubmed|18763711]
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|1A9F7847AA1EB2A264842B44CD1B1A21F0AF6E57|purE]-[gene|0DA73E4D1935F6A91BE251EF2704A11DE5D81174|purK]-[gene|29FF54E2B9F4A11811F5E15885A4C02A259C7B35|purB]-[gene|447D12E940C7F45B6C5015844F9DED9D513CD6E5|purC]-[gene|CCD4DA969086181CFA33D6D241F2CAAE02E0C758|purS]-[gene|DEE856E83E790EB57F103F7A9156408AF090995D|purQ]-[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]-[gene|4AA5AF9C7CE8D0A9FD3A47650ECF130BCBEE1952|purF]-[gene|AD0DE9457D70DF02FA0F58867B24ABF236FAF65A|purM]-[gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]-[gene|54CE8EB2F5D1F9AEAA497E1F60248C9B2250B01E|purH]-[gene|9BBA22B09C6DD6C36E043D44B0F54BD0FFA5BA0E|purD]
    description
    [Pubmed|3036807]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|3036807], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, ([SW|riboswitch]) [pubmed|3036807,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|7638212,2536750], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • expression activated by glucose (4.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE06480 (Δ[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAAGCAGTAGTGACATG, downstream forward: _UP4_CCATGCTTGCTGAAATCAAA
  • BKK06480 (Δ[gene|D34203FAA84C19B34B3CB5F00AC2E2663FFA344D|purL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GTTCAAGCAGTAGTGACATG, downstream forward: _UP4_CCATGCTTGCTGAAATCAAA
  • References

  • 15301530,3036807,12923093,21671997,7638212,18763711,15378759