SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


response regulator aspartate phosphatase ([protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|RapA]) inhibitor, control of the [SW|phosphorelay]
4.66 kDa
protein length
gene length
135 bp Sequence Blast
control of [SW|sporulation] initiation
phosphatase ([protein|25D89EF3C4D57B3E6F9AB0210029651F74356906|RapA]) inhibitor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Control of response regulators/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Other protein controlling the activity of the phosphorelay]
  • [category|SW 6|Groups of genes] → [category|SW 6.8|Short peptides]
  • Gene

    1,316,995 → 1,317,129

    The protein

    Protein family

  • [SW|phr family] (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1378051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]) [Pubmed|16091051], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [Pubmed|23569278,12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
  • view in new tab

    Biological materials


  • BKE12440 (Δ[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAGATTTCATATAAACA, downstream forward: _UP4_TGATGCATAAAAAAAGACCC
  • BKK12440 (Δ[gene|D31B325366D3F0169E4ECA8871645C7826019C10|phrA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTTAGATTTCATATAAACA, downstream forward: _UP4_TGATGCATAAAAAAAGACCC
  • References

  • 8643670,8730857,11923303,1378051,14651647,12618455,12107147,19380751,16091051,20238180,27122155