SubtiBank SubtiBank
nadB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

nadB

L-aspartate oxidase
locus
BSU_27870
pI
6.45
mw
58.07 kDa
protein length
531 aa Sequence Blast
gene length
1596 bp Sequence Blast
function
NAD biosynthesis
product
L-aspartate oxidase
essential
no
ec
1.4.3.16
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.11|Biosynthesis of NAD(P)]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    2,847,871 → 2,849,466

    The protein

    Catalyzed reaction/ biological activity

  • L-aspartate + O2 --> H2O2 + iminosuccinate (according to UniProt)
  • Protein family

  • FAD-dependent oxidoreductase 2 family (with [protein|0E1FAF4B3A967CC3882B3DDB3CA2D01FD70A0F7E|SdhA], according to UniProt)
  • Modification

  • phosphorylated on Arg-104 [Pubmed|22517742]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|5KXJ] (from Salmonella typhimurium, 38% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]-[gene|1368734DCC28C618AA173B865784BDDAEA912623|nadC]-[gene|F92F17578F06EF2292D0923662933463D7C86498|nadA]
    description
    [Pubmed|8444804]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8444804], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|16199587], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|16199587]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|nadB]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • BKE27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG, downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
  • BKK27870 (Δ[gene|D30D059185DFB828AB0FD07D600DBC3FD0973198|nadB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGCCATCCTCCTGTTG, downstream forward: _UP4_AGAAAAAACGAGGGGATTTG
  • labs

  • [SW|Alessandra Albertini], University of Pavia, Italy [http://www-1.unipv.it/genbiom/albertini.html homepage]
  • References

  • 8444804,18959769,16199587,20525796,22517742