SubtiBank SubtiBank
yeaA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yeaA

unknown
locus
BSU_06290
pI
7.41
mw
37.58 kDa
protein length
329 aa Sequence Blast
gene length
990 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydjQ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    682,375 → 683,364

    Expression and Regulation

    Operons

    genes
    [gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]-[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]-[gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C224 (ydjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2222 NBRP B. subtilis, Japan]
  • BKE06290 (Δ[gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGCAGCTCCTTTT, downstream forward: _UP4_GATGGAAACTAAAGGAGGAG
  • BKK06290 (Δ[gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAGCAGCTCCTTTT, downstream forward: _UP4_GATGGAAACTAAAGGAGGAG
  • References

  • 9987136,15699190