SubtiBank SubtiBank
pdp
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pdp

pyrimidine nucleoside phosphorylase
locus
BSU_39400
pI
4.76
mw
46.04 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
function
pyrimidine interconversion
product
pyrimidine nucleoside phosphorylase
essential
no
ec
2.4.2.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    4,049,009 → 4,050,310

    The protein

    Catalyzed reaction/ biological activity

  • phosphate + uridine --> α-D-ribose 1-phosphate + uracil (according to UniProt)
  • phosphate + thymidine --> 2-deoxy-α-D-ribose 1-phosphate + thymine (according to UniProt)
  • 2'-deoxyuridine + phosphate --> 2-deoxy-α-D-ribose 1-phosphate + uracil (according to UniProt)
  • Protein family

  • thymidine/pyrimidine-nucleoside phosphorylase family (single member, according to UniProt)
  • Structure

  • [PDB|5OLN] [PubMed|29633966]
  • Expression and Regulation

    Operons

    genes
    [gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]
    description
    [Pubmed|8550462]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • BKE39400 (Δ[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGGTCACCGATCCT, downstream forward: _UP4_TAAAAAATAAAGCACATCCC
  • BKK39400 (Δ[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGGTCACCGATCCT, downstream forward: _UP4_TAAAAAATAAAGCACATCCC
  • References

  • 11065368,8550462,10074062,10666464,26883633,29633966,9817849