SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


pyrimidine nucleoside phosphorylase
46.04 kDa
protein length
433 aa Sequence Blast
gene length
1302 bp Sequence Blast
pyrimidine interconversion
pyrimidine nucleoside phosphorylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    4,049,009 → 4,050,310

    The protein

    Catalyzed reaction/ biological activity

  • phosphate + uridine --> α-D-ribose 1-phosphate + uracil (according to UniProt)
  • phosphate + thymidine --> 2-deoxy-α-D-ribose 1-phosphate + thymine (according to UniProt)
  • 2'-deoxyuridine + phosphate --> 2-deoxy-α-D-ribose 1-phosphate + uracil (according to UniProt)
  • Protein family

  • thymidine/pyrimidine-nucleoside phosphorylase family (single member, according to UniProt)
  • Structure

  • [PDB|5OLN] [PubMed|29633966]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8550462], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR]: repression, [Pubmed|8550462], in [regulon|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|DeoR regulon]
  • regulation

  • induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials


  • BKE39400 (Δ[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGGTCACCGATCCT, downstream forward: _UP4_TAAAAAATAAAGCACATCCC
  • BKK39400 (Δ[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTGGTCACCGATCCT, downstream forward: _UP4_TAAAAAATAAAGCACATCCC
  • References

  • 11065368,8550462,10074062,10666464,26883633,29633966,9817849