SubtiBank SubtiBank
yqaB

yqaB

similar to phage-related protein
locus
BSU_26380
pI
7.96
mw
20.50 kDa
protein length
172 aa Sequence Blast
gene length
519 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,700,838 → 2,701,356

    Expression and Regulation

    Operons

    genes
    [gene|D2AE5BD8CDEAE18E58B485552B477321378AAA4E|yqaB]-[gene|6FAD8804AA32B84819DDE57C0AF63F208FB9FFD1|sigKC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE26380 (Δ[gene|D2AE5BD8CDEAE18E58B485552B477321378AAA4E|yqaB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAACCTCCTTA, downstream forward: _UP4_AGTCAAACTGTTACGGGAAA
  • BKK26380 (Δ[gene|D2AE5BD8CDEAE18E58B485552B477321378AAA4E|yqaB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26380 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGATGAAAAACCTCCTTA, downstream forward: _UP4_AGTCAAACTGTTACGGGAAA