SubtiBank SubtiBank
yfjQ
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yfjQ

minor magnesium transporter
locus
BSU_08000
pI
5.42
mw
37.69 kDa
protein length
319 aa Sequence Blast
gene length
960 bp Sequence Blast
function
magnesium uptake
product
minor magnesium transporter
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.1|Metal ion homeostasis (K, Na, Ca, Mg)] → [category|SW 1.3.1.1|Magnesium uptake/ efflux]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    871,347 → 872,306

    Phenotypes of a mutant

  • a ''[gene|472E3A2407C83EEE26DB00079D185C4EA2988611|mgtE] [gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]'' mutant does not grow on rich media, this can be suppressed by the addition of 25 mM Mg2+, moreover the mutant grows well on minimal medium in the presence of citrate (due to the activity of [protein|C0DED68802EF78D2BC16507234AAC3B60D236E68|CitM]) [Pubmed|24415722]
  • The protein

    Protein family

  • CorA metal ion transporter (MIT) (TC 1.A.35) family (together with [protein|F0CACEFB53F4BC38DF77A38C4D78BA3DBE96E21A|CorA]) (according to UniProt)
  • Structure

  • [PDB|4I0U] (from Thermotoga maritima, 37% identity) [pubmed|23425532]
  • Expression and Regulation

    Operons

    genes
    [gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C274 (yfjQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2272 NBRP B. subtilis, Japan]
  • BKE08000 (Δ[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAACCCTCCACCTG, downstream forward: _UP4_TGAGGACAGCGAGCAGCTGT
  • BKK08000 (Δ[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAACAACCCTCCACCTG, downstream forward: _UP4_TGAGGACAGCGAGCAGCTGT
  • GP2853 (''[gene|D281B88EC444F8175AB50FB2CD24B51F4E2C96F8|yfjQ]''::''tet''), available in [SW|Jörg Stülke]'s lab
  • References

  • 24415722,23425532