SubtiBank SubtiBank
ypjA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ypjA

unknown
locus
BSU_22530
pI
5.35
mw
21.00 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,362,407 → 2,362,964

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A424 (ypjA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/424 NBRP B. subtilis, Japan]
  • BKE22530 (Δ[gene|D2588A01D46535293CFA7FF1A66E9C132FF5F69E|ypjA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGCCGCTGCCCTAATA, downstream forward: _UP4_TAAAGACAATGTTGGTCTAT
  • BKK22530 (Δ[gene|D2588A01D46535293CFA7FF1A66E9C132FF5F69E|ypjA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGCCGCTGCCCTAATA, downstream forward: _UP4_TAAAGACAATGTTGGTCTAT