SubtiBank SubtiBank
yobL

yobL

toxin
locus
BSU_19000
pI
6.50
mw
67.59 kDa
protein length
600 aa Sequence Blast
gene length
1803 bp Sequence Blast
function
unknown
product
toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    2,071,754 → 2,073,556

    The protein

    [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A309 (yobL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/309 NBRP B. subtilis, Japan]
  • BKE19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • BKK19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • References

  • 22200572