SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


67.59 kDa
protein length
600 aa Sequence Blast
gene length
1803 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    2,071,754 → 2,073,556

    The protein


  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Biological materials


  • MGNA-A309 (yobL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • BKK19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • References

  • 22200572