SubtiBank SubtiBank
yobL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yobL

toxin
locus
BSU_19000
pI
6.50
mw
67.59 kDa
protein length
600 aa Sequence Blast
gene length
1803 bp Sequence Blast
function
unknown
product
toxin
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • Gene

    Coordinates
    2,071,754 → 2,073,556

    The protein

    [SW|Domains]

  • [SW|LXG domain] (aa 1-235) (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-A309 (yobL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/309 NBRP B. subtilis, Japan]
  • BKE19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • BKK19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTA
  • References

  • 22200572