The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
yobL
Genomic Context
categories
[category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW 4.3.17.2|Type 2 TA systems][category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]Gene
Coordinates
2,071,754 → 2,073,556
The protein
[SW|Domains]
[SW|LXG domain] (aa 1-235) (according to UniProt)Biological materials
Mutant
MGNA-A309 (yobL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/309 NBRP B. subtilis, Japan]BKE19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTABKK19000 (Δ[gene|D24F5B473B9CFAD960D877A8BA593939012177E2|yobL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCATTCTCCTTCCTAG, downstream forward: _UP4_TGAGGTGTTTATATGATTTAReferences