The second international online conference
#Subtillery2021 will be held 14th - 18th June - save the date, for more information see the
conference website!
The 21st
International Conference on Bacilli has been postponed to 2022 and will take place in Prague.
yokG
similar to delta-endotoxin
Genomic Context
categories
[category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity][category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]Gene
Coordinates
2,278,602 → 2,279,675
The protein
Protein family
cry6A endotoxin family (single member, according to UniProt)Structure
[PDB|5GHE] (Cry6Aa from B. thuringiensis, 31% identity) [pubmed|27381865]Biological materials
Mutant
BKE21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAABKK21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAAReferences