SubtiBank SubtiBank
yokG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yokG

similar to delta-endotoxin
locus
BSU_21600
pI
4.20
mw
40.58 kDa
protein length
357 aa Sequence Blast
gene length
1074 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,278,602 → 2,279,675

    The protein

    Protein family

  • cry6A endotoxin family (single member, according to UniProt)
  • Structure

  • [PDB|5GHE] (Cry6Aa from B. thuringiensis, 31% identity) [pubmed|27381865]
  • Biological materials

    Mutant

  • BKE21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
  • BKK21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
  • References

    Research papers

  • 27381865