SubtiBank SubtiBank
yokG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yokG

similar to delta-endotoxin
locus
BSU_21600
pI
4.20
mw
40.58 kDa
protein length
357 aa Sequence Blast
gene length
1074 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.18|Toxins, antitoxins and immunity against toxins/ based on similarity]
  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,278,602 → 2,279,675

    The protein

    Protein family

  • cry6A endotoxin family (single member, according to UniProt)
  • Structure

  • [PDB|5GHE] (Cry6Aa from B. thuringiensis, 31% identity) [pubmed|27381865]
  • Biological materials

    Mutant

  • BKE21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
  • BKK21600 (Δ[gene|D2029DC18EDCF6342986A63A37AEADDA54C5755F|yokG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTGACCCGCCCTTT, downstream forward: _UP4_TAAAAAATGGGTAATCTGAA
  • References

    Research papers

  • 27381865