SubtiBank SubtiBank
ydjJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydjJ

unknown
locus
BSU_06220
pI
6.49
mw
37.63 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    674,832 → 675,857

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D1FD189BE46CBC411699DB4819B300AC59445F8F|ydjJ]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C217 (ydjJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2215 NBRP B. subtilis, Japan]
  • BKE06220 (Δ[gene|D1FD189BE46CBC411699DB4819B300AC59445F8F|ydjJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGGTTGCCTCCCTTA, downstream forward: _UP4_TAAAAAAGTCCCGAGTGCTG
  • BKK06220 (Δ[gene|D1FD189BE46CBC411699DB4819B300AC59445F8F|ydjJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGGTTGCCTCCCTTA, downstream forward: _UP4_TAAAAAAGTCCCGAGTGCTG