SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


cysteine synthase, trigger enzyme
32.67 kDa
protein length
308 aa Sequence Blast
gene length
927 bp Sequence Blast
biosynthesis of cysteine, control of [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR] activity
cysteine synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of cysteine]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of transcription factor (other than two-component system)]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.3|Trigger enzyme] → [category|SW|Trigger enzymes that control gene expression by protein-protein interaction with transcription factors]
  • Gene

    81,771 → 82,697

    Phenotypes of a mutant

  • constitutive expression of the ''[gene|51EB09C122A7166D662AE72842A44EC5FBA03134|cysH]-[gene|58A5A7F12664EC38AC21E24C1AD89671D7E648CF|cysP]-[gene|6CF2A9A517B641C44C0B46EF242BC5E668EA846B|sat]-[gene|3C71659E4868744A9301C26608EABF7B98217DCF|cysC]-[gene|92831D5A8E07A18BA6C6978123769D00D685BB45|ylnD]-[gene|9349C4646A56F933041EBE750F1BE86BAE7A60D9|sirB]-[gene|8BAB9B12D9D58A45446DC6CB7F48869089800FD3|ylnF]'' operon, auxotrophic for cysteine
  • a [gene|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|mccA] [gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK] double mutant is auxotrophic for cysteine [pubmed|17056751]
  • The protein

    Catalyzed reaction/ biological activity

  • O(3)-acetyl-L-serine + H2S --> L-cysteine + acetate (according to UniProt)
  • Protein family

  • Cysteine synthase/cystathionine beta-synthase family (with [protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|MccA] and [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|YtkP], according to UniProt)
  • Paralogous protein(s)

  • [protein|F195C47849F4F6B4C56E3A386F5D8C84326B01C4|MccA], [protein|6F1462EA074DEDE2FEF13561A6691A22BFAD10FE|YtkP]
  • [SW|Cofactors]

  • PLP (according to Swiss-Prot)
  • Structure

  • [PDB|1Y7L] (from ''Haemophilus influenzae'', 39% identity, 52% similarity) [Pubmed|15838047]
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [pubmed|30480837], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • induced by heat stress ([protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]) [pubmed|30480837]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11445163], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|50930C56C27D22715620A350220E3C56ADB41020|CymR]: repression, [Pubmed|16513748], in [regulon|50930C56C27D22715620A350220E3C56ADB41020|CymR regulon]
  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|12642660,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • regulation

  • repressed by casamino acids [Pubmed|12107147]
  • view in new tab

    Biological materials


  • 1A834 ( ''cysK''::''kan''), [Pubmed| ], available at [ BGSC]
  • 1A801 ( ''cysK''::''spec''), [Pubmed|11445163], available at [ BGSC]
  • 1A803 ( ''cysK''::''spec''), [Pubmed|11445163], available at [ BGSC]
  • 1A946 ( ''cysK''::''spec''), [Pubmed|17056751], available at [ BGSC]
  • BKE00730 (Δ[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGACACCTCAATTT, downstream forward: _UP4_TAAAAAAAGCCAAAACTCCC
  • BKK00730 (Δ[gene|D1FC976597E5583E40A4ED7234FBCA743AB01354|cysK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTCGACACCTCAATTT, downstream forward: _UP4_TAAAAAAAGCCAAAACTCCC
  • labs

  • [[Isabelle Martin-Verstraete]], Institute Pasteur, Paris, France
  • References

  • 16513748,17056751,18974048,16267287,12642660,11445163,12107147,15838047,9084182,15378759