SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


inner spore coat protein
40.41 kDa
protein length
341 aa Sequence Blast
gene length
1026 bp Sequence Blast
protection of the spore
inner spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class III]
  • Gene

    2,869,964 → 2,870,989

    The protein


  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,8449878], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,8449878]
  • view in new tab

    Biological materials


  • MGNA-A997 (ysxE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28100 (Δ[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCACCACATTTT, downstream forward: _UP4_TCTTAATGGCGCGGACTTGT
  • BKK28100 (Δ[gene|D1EAEC9C88EDDD8FB2E7E315DE28A7A54AAAB4D2|ysxE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCATTCACCACATTTT, downstream forward: _UP4_TCTTAATGGCGCGGACTTGT
  • References

  • 15699190,8449878,12107147,22171814