SubtiBank SubtiBank
gerKB
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gerKB

nutrient receptor
locus
BSU_03720
pI
8.92
mw
41.61 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
function
germination
product
nutrient receptor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.1|Germinant receptors]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    422,982 → 424,103

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • [SW|Spore germination protein (SGP) (TC 2.A.3.9) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|D70EC7C02BC79BED724489ABCB6356447F215B87|GerBB], [protein|5FF739B8C087207039BB6DC293EE77F59337ED0B|GerAB], [protein|B14179D0EF5D3493E5CDB8E15378A5088B4FFD10|YndE]
  • [SW|Localization]

  • spore inner membrane [Pubmed|21696470]
  • Expression and Regulation

    Operons

    genes
    [gene|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[gene|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC]-[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16707705], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: repression, [Pubmed|16707705], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed during sporulation ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|16707705]
  • additional information

  • 700 molecules are present per spore [PubMed|23749970]
  • view in new tab

    Biological materials

    Mutant

  • BKE03720 (Δ[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCACTTCCCCTTTC, downstream forward: _UP4_TGATAAAAAGAGCGGGGGGA
  • BKK03720 (Δ[gene|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03720 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCACTTCCCCTTTC, downstream forward: _UP4_TGATAAAAAGAGCGGGGGGA
  • References

  • 16707705,21696470,16352818,23396907,26731423,32210351