SubtiBank SubtiBank
yerD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yerD

general stress protein, similar to glutamate synthase (ferredoxin), required for protection against paraquat stress
locus
BSU06590
pI
7.35
mw
58.58 kDa
protein length
525 aa Sequence Blast
gene length
1578 bp Sequence Blast
function
protection against paraquat stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    716,780 → 718,357

    The protein

    Paralogous protein(s)

  • [protein|44DF1B7E476AD58B3CCC39300FFE0132D0D32AD0|GltA]
  • [SW|Cofactors]

  • FMN or FAD [Pubmed|21635694]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A925 (yerD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/925 NBRP B. subtilis, Japan]
  • GP1184 (tet) available in [SW|Jörg Stülke]'s lab
  • BKE06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT, downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
  • BKK06590 (Δ[gene|D1AF9DA2594D2E2A94DC207A870C8495954A7A17|yerD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTCAGCCTCCCTTTT, downstream forward: _UP4_TAAAGAAACCGCCCTTGCCA
  • Expression vectors

  • pBP32 (expression vector for ''E. coli'' BL21; N-terminal Strep-tag-YerD fusion protein, based on [SW|pGP172]), available in [SW|Fabian Commichau]'s lab
  • FLAG-tag construct

  • GP1187 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • labs

  • [SW|Fabian Commichau], Göttingen, Germany [http://www.uni-goettingen.de/de/413008.html homepage]
  • References

  • 15805528,22383849,23033921,22582280