SubtiBank SubtiBank
smpB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

smpB

tmRNA-binding protein
locus
BSU33600
pI
10.42
mw
17.95 kDa
protein length
156 aa Sequence Blast
gene length
471 bp Sequence Blast
function
trans-translation
product
tmRNA-binding protein
essential
no
synonyms
yvaI

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • Gene

    Coordinates
    3,451,248 → 3,451,718

    Phenotypes of a mutant

  • impaired growth at high and low temperatures [Pubmed|15805528]
  • inactivation of ''[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]'' reduces sporulation efficiency to 23% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
  • The protein

    Protein family

  • smpB family (according to Swiss-Prot)
  • Structure

  • [PDB|1P6V] (from ''Aquifex aeolicus'', 55% identity, complex with the tRNA domain of [protein|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|SsrA]) [Pubmed|12904796]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': [protein|search|SigB] [Pubmed|11544224]
  • view in new tab

    genes
    [gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A494 (yvaI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/494 NBRP B. subtilis, Japan]
  • BKE33600 (Δ[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAACCTCCTCTCT, downstream forward: _UP4_TAAAGGCATAGTGCTTGATT
  • BKK33600 (Δ[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33600 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCAGAACCTCCTCTCT, downstream forward: _UP4_TAAAGGCATAGTGCTTGATT
  • labs

  • [SW|Chet Price], Davis, USA [http://foodscience.ucdavis.edu/price_lab/pricelab.html homepage]
  • References

    Reviews

  • 12730326,10881189
  • Original publications

  • 18977770,11395451,17369301,10881189,15805528,12904796,26735940