SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


protein tyrosine phosphatase
27.31 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
protein tyrosine phosphatase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein phosphatases]
  • Gene

    1,239,387 → 1,240,121

    Phenotypes of a mutant

  • increased amounts of small aci-soluble spore proteins (SASPs) [Pubmed|21092197]
  • The protein

    Catalyzed reaction/ biological activity

  • H2O + P1,P4-bis(5'-guanosyl) tetraphosphate --> GMP + GTP + 2 H+ (according to UniProt)
  • Protein family

  • prpE family (single member, according to UniProt)
  • Structure

  • [PDB|4J6O] (PnkP from Thermocellum sp., 48% identity) [pubmed|23595150]
  • [SW|Localization]

  • forespore (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B162 (yjbP::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC, downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
  • BKK11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC, downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
  • References

  • 12059787,16740944,21092197,22383849,23824080,23595150