SubtiBank SubtiBank
prpE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

prpE

protein tyrosine phosphatase
locus
BSU_11630
pI
6.75
mw
27.31 kDa
protein length
244 aa Sequence Blast
gene length
735 bp Sequence Blast
function
unknown
product
protein tyrosine phosphatase
essential
no
ec
3.6.1.17
synonyms
yjbP

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • Gene

    Coordinates
    1,239,387 → 1,240,121

    Phenotypes of a mutant

  • increased amounts of small aci-soluble spore proteins (SASPs) [Pubmed|21092197]
  • The protein

    Catalyzed reaction/ biological activity

  • P1,P(4)-bis(5'-guanosyl) tetraphosphate + H2O = GTP + GMP (according to Swiss-Prot)
  • Protein family

  • prpE family (single member, according to UniProt)
  • Structure

  • [PDB|4J6O] (PnkP from Thermocellum sp., 48% identity) [pubmed|23595150]
  • [SW|Localization]

  • forespore (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B162 (yjbP::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1161 NBRP B. subtilis, Japan]
  • BKE11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE11630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC, downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
  • BKK11630 (Δ[gene|D1661093571DA4DEC5FBD8EDD3910879DAFDEE23|prpE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK11630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGGTCTCCTCCTTACC, downstream forward: _UP4_CGCCCCATATAAAAAAGGAG
  • References

  • 12059787,16740944,21092197,22383849,23824080,23595150