SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


23.08 kDa
protein length
211 aa Sequence Blast
gene length
636 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    2,564,923 → 2,565,558

    The protein

    Protein family

  • [SW|metallo-beta-lactamase superfamily] (according to UniProt)
  • Structure

  • [PDB|2ZWR] (from Thermus thermophilus, 41% identity) [SW|19407375]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C477 (yqgX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE24790 (Δ[gene|D1597B17244343FC70C83EA96596479DA925C033|yqgX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATTATCACCTCTTTCT, downstream forward: _UP4_TAAAAAAAGAGACAAACCGA
  • BKK24790 (Δ[gene|D1597B17244343FC70C83EA96596479DA925C033|yqgX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTATTATCACCTCTTTCT, downstream forward: _UP4_TAAAAAAAGAGACAAACCGA
  • References

    Research papers

  • 19407375