SubtiBank SubtiBank
sspL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sspL

small acid-soluble spore protein (minor SASP)
locus
BSU22000
pI
10.31
mw
4.56 kDa
protein length
gene length
129 bp Sequence Blast
function
protection of spore DNA
product
small acid-soluble spore protein (minor SASP)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.3|Small acid-soluble spore proteins]
  • Gene

    Coordinates
    2,310,859 → 2,310,987

    The protein

    Protein family

  • cyclophilin-type PPIase family (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]
    description
    [Pubmed|10333516]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|search|SigG]) [Pubmed|15699190,10333516]
  • view in new tab

    Biological materials

    Mutant

  • BKE22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA, downstream forward: _UP4_AGCAATACAAAACGCTAGAG
  • BKK22000 (Δ[gene|D105FCA5F5249A96CC35581D258F78AF82CFEA3B|sspL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTAGTTCACCTCGCCA, downstream forward: _UP4_AGCAATACAAAACGCTAGAG
  • References

  • 10333516