SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


copper transporter
59.64 kDa
protein length
541 aa Sequence Blast
gene length
1626 bp Sequence Blast
uptake of copper
copper transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Metal ion transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW|Copper]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    446,801 → 448,426

    Phenotypes of a mutant

  • growth-defective under copper-limiting conditions [Pubmed|19168619]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of copper [Pubmed|19168619]
  • Protein family

  • N-terminal part: CopC family (single member, according to UniProt)
  • C-terminal part: CopD family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|19168619]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22904286], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK]: repression, [Pubmed|22904286,19168619], in [regulon|98D807FBB847BF731B5C236557C8F70347279CE0|YcnK regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|15101989], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by copper limitation ([protein|search|YcnK]) [Pubmed|22904286,19168619]
  • view in new tab

    Biological materials


  • BKE03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT, downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
  • BKK03950 (Δ[gene|D0F553E661A35C69380ACB01D9A96FC6C5088470|ycnJ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACTCAGACACCACCTT, downstream forward: _UP4_AAGACCAATTAAGGAGTGTT
  • labs

  • [SW|Mohamed Marahiel], Marburg University, Germany [ homepage]
  • References

  • 19168619,22904286,22383849