SubtiBank SubtiBank
pucC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pucC

xanthine dehydrogenase
locus
BSU_32490
pI
8.58
mw
29.97 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
function
purine utilization
product
xanthine dehydrogenase
essential
no
synonyms
yurD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.1|Utilization of nucleotides]
  • Gene

    Coordinates
    3,338,501 → 3,339,334

    RNA

    Catalyzed reaction/ biological activity

  • H2O + NAD+ + xanthine --> H+ + NADH + urate (according to UniProt)
  • H2O + hypoxanthine + NAD+ --> H+ + NADH + xanthine (according to UniProt)
  • The protein

    Catalyzed reaction/ biological activity

  • Xanthine NAD H2O = urate NADH (according to Swiss-Prot)
  • [SW|Domains]

  • [SW|FAD-binding PCMH-type domain] (aa 7-176) (according to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|1JRO] (from ''Rhodobacter capsulatus'', 39% identity, 55% similarity) [Pubmed|11796116]
  • Expression and Regulation

    Operons

    genes
    [gene|C9370B221117B89A1134B413748D39505C2E1DA8|pucA]-[gene|99428BD0B1A8E91F4B028ACF8AB51B235DDB4F11|pucB]-[gene|D0F00ACF5AAD9E9418033F5B47527C4D50007F18|pucC]-[gene|B65E4B340961332ED0ACC7FD957351256F708F60|pucD]-[gene|6855CC156FCB4C4A16AFD6ADE18F3FFC82B61843|pucE]
    description
    [Pubmed|12823818]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029039], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|52C1601482C26400A524E880334BB801F832D6ED|PucR]: activation, [Pubmed|12029039], in [regulon|52C1601482C26400A524E880334BB801F832D6ED|PucR regulon]
  • regulation

  • induced in the presence of purine nucleotides (effector: allantoin) ([protein|search|PucR]) [Pubmed|12029039]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A940 (yurD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/940 NBRP B. subtilis, Japan]
  • BKE32490 (Δ[gene|D0F00ACF5AAD9E9418033F5B47527C4D50007F18|pucC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTTGCTTTTGTCACTTGGC, downstream forward: _UP4_CTGATGGCTGAGGGAGGGGA
  • BKK32490 (Δ[gene|D0F00ACF5AAD9E9418033F5B47527C4D50007F18|pucC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32490 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCTTGCTTTTGTCACTTGGC, downstream forward: _UP4_CTGATGGCTGAGGGAGGGGA
  • References

  • 11344136,12029039,12823818