SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


alkyl hydroperoxide reductase (small subunit)
20.48 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
resistance against peroxide stres
alkyl hydroperoxide reductase (small subunit)

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    4,118,950 → 4,119,513

    The protein

    Catalyzed reaction/ biological activity

  • [protein]-dithiol + hydroperoxide --> [protein]-disulfide + alcohol + H2O (according to UniProt)
  • Protein family

  • [SW|peroxiredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|AhpA]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 2-157) (according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|1WE0] (from ''Amphibacillus xylanus'', 78% identity, 88% similarity) [Pubmed|15770647]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8932314], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials


  • GP1730 [gene|search|ahpCF]::mls trpC2 available at Jörg Stülkes lab
  • BKE40090 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
  • BKK40090 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
  • References

  • 11532148,15378759,8932314,8932315,16493705,15581580,15770647