SubtiBank SubtiBank
ahpC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ahpC

alkyl hydroperoxide reductase (small subunit)
locus
BSU40090
pI
4.28
mw
20.48 kDa
protein length
187 aa Sequence Blast
gene length
564 bp Sequence Blast
function
resistance against peroxide stres
product
alkyl hydroperoxide reductase (small subunit)
essential
no
ec
1.11.1.15
synonyms
perR

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    Coordinates
    4,118,950 → 4,119,513

    The protein

    Catalyzed reaction/ biological activity

  • 2 R'-SH + ROOH = R'-S-S-R' + H2O + ROH (according to Swiss-Prot)
  • Protein family

  • [SW|peroxiredoxin family] (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B283B702D917E310130BC33A40BF6A5853C3D4C1|AhpA]
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • Structure

  • [PDB|1WE0] (from ''Amphibacillus xylanus'', 78% identity, 88% similarity) [Pubmed|15770647]
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]-[gene|8F23B575BC32EA63267C4321DD8E4BD546B11AF1|ahpF]
    description
    [Pubmed|8932314]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8932314], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|11532148], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced by H2O2 ([protein|search|PerR]) [Pubmed|11532148]
  • view in new tab

    Biological materials

    Mutant

  • GP1730 [gene|search|ahpCF]::mls trpC2 available at Jörg Stülkes lab
  • BKE40090 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
  • BKK40090 (Δ[gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40090 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATGTATATTCCTCCTA, downstream forward: _UP4_GGTAAAATCTAAGGAGTGCA
  • References

  • 11532148,15378759,8932314,8932315,16493705,15581580,15770647