SubtiBank SubtiBank
yhjG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhjG

similar to monooxygenase
locus
BSU_10500
pI
6.69
mw
54.19 kDa
protein length
499 aa Sequence Blast
gene length
1500 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,122,862 → 1,124,361

    The protein

    Protein family

  • PheA/TfdB FAD monooxygenase family (single member, accoridng to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4K2X] (from ''Streptomyces Rimosus'', 43% identity) [pubmed|23621493]
  • Expression and Regulation

    Operons

    genes
    [gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]-[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B285 (yhjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1284 NBRP B. subtilis, Japan]
  • BKE10500 (Δ[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCACTCCTTTTGTT, downstream forward: _UP4_TAATTCAATTCGATTGTTTC
  • BKK10500 (Δ[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCACTCCTTTTGTT, downstream forward: _UP4_TAATTCAATTCGATTGTTTC
  • References

    Research papers

  • 23621493