SubtiBank SubtiBank
yhjG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhjG

similar to monooxygenase
locus
BSU_10500
pI
6.69
mw
54.19 kDa
protein length
499 aa Sequence Blast
gene length
1500 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,122,862 → 1,124,361

    The protein

    Protein family

  • PheA/TfdB FAD monooxygenase family (single member, accoridng to UniProt)
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4K2X] (from ''Streptomyces Rimosus'', 43% identity) [pubmed|23621493]
  • Expression and Regulation

    Operons

    genes
    [gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]-[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]
    description
    [Pubmed|22383849]
    view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials

    Mutant

  • MGNA-B285 (yhjG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1284 NBRP B. subtilis, Japan]
  • BKE10500 (Δ[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCACTCCTTTTGTT, downstream forward: _UP4_TAATTCAATTCGATTGTTTC
  • BKK10500 (Δ[gene|D07BD51E1DDEDA3CE292570AAEAE14C27C064A67|yhjG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCACCACTCCTTTTGTT, downstream forward: _UP4_TAATTCAATTCGATTGTTTC
  • References

    Research papers

  • 23621493