SubtiBank SubtiBank
albF

albF

antilisterial bacteriocin (subtilosin) production
locus
BSU_37420
pI
5.42
mw
48.82 kDa
protein length
426 aa Sequence Blast
gene length
1281 bp Sequence Blast
function
antilisterial bacteriocin (subtilosin) production
product
unknown
essential
no
synonyms
ywhN

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.1|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,841,017 → 3,842,297

    The protein

    Protein family

  • [SW|Peptidase M16 family] (according to UniProt)
  • Structure

  • [PDB|4XEA] (from Alicyclocacillus acidocaldarius, corresponds to aa 21 ... 207, 26% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
    description
    [Pubmed|10572140]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|10572140], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok]: repression, [Pubmed|15743949], in [regulon|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|Rok regulon]
  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|10809710], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [PubMed|10572140,17720793], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|10809710]
  • expression of the operon is strongly induced at the beginning of [SW|biofilm formation] [pubmed|31113899]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A526 (ywhN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/526 NBRP B. subtilis, Japan]
  • BKE37420 (Δ[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCATCCCCTTACT, downstream forward: _UP4_CAATGAAACAAAGCACTGTC
  • BKK37420 (Δ[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTTCATCCCCTTACT, downstream forward: _UP4_CAATGAAACAAAGCACTGTC
  • References

  • 10809709,10572140,15743949,10809710,10572140,17720793