SubtiBank SubtiBank
azoR1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

azoR1

azoreductase, involved in quinone detoxification
locus
BSU19230
pI
4.99
mw
22.83 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
function
quinone detoxification
product
azoreductase
essential
no
synonyms
yocJ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,096,350 → 2,096,976

    The protein

    Paralogous protein(s)

  • [protein|0E2B1914A040666BAF042C0BE3F468144E1F1E06|AzoR2]
  • Structure

  • [PDB|3P0R] (from B. anthracis, 64% identity, 81% similarity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [pubmed|18208493], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • regulation

  • induced by thiol-reactive compounds (catechol, menaquinone) ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]) [pubmed|18208493]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B415 (yocJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1414 NBRP B. subtilis, Japan]
  • BKE19230 (Δ[gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCTCCCGGTA, downstream forward: _UP4_TAATAAAGCCAAGACTCCTA
  • BKK19230 (Δ[gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCTCCCGGTA, downstream forward: _UP4_TAATAAAGCCAAGACTCCTA
  • References

  • 18208493,17725564,15378759