SubtiBank SubtiBank
azoR1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

azoR1

azoreductase, involved in quinone detoxification
locus
BSU_19230
pI
4.99
mw
22.83 kDa
protein length
208 aa Sequence Blast
gene length
627 bp Sequence Blast
function
quinone detoxification
product
azoreductase
essential
no
synonyms
yocJ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    2,096,350 → 2,096,976

    The protein

    Catalyzed reaction/ biological activity

  • anthranilate + N,N-dimethyl-1,4-phenylenediamine + 2 NAD+ --> 2-(4-dimethylaminophenyl)diazenylbenzoate + 2 H+ + 2 NADH (according to UniProt)
  • Protein family

  • azoreductase type 1 family (with [protein|0E2B1914A040666BAF042C0BE3F468144E1F1E06|AzoR2], according to UniProt)
  • Paralogous protein(s)

  • [protein|0E2B1914A040666BAF042C0BE3F468144E1F1E06|AzoR2]
  • Structure

  • [PDB|3P0R] (from B. anthracis, 64% identity, 81% similarity)
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]: repression, [pubmed|18208493], in [regulon|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB regulon]
  • regulation

  • induced by thiol-reactive compounds (catechol, menaquinone) ([protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB]) [pubmed|18208493]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B415 (yocJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1414 NBRP B. subtilis, Japan]
  • BKE19230 (Δ[gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCTCCCGGTA, downstream forward: _UP4_TAATAAAGCCAAGACTCCTA
  • BKK19230 (Δ[gene|CFFFFE96FB7AEEF7190F81332369F0A6834C34A4|azoR1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19230 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGTATTCCTCCCGGTA, downstream forward: _UP4_TAATAAAGCCAAGACTCCTA
  • References

  • 18208493,17725564,15378759