SubtiBank SubtiBank
prmC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

prmC

similar to N5-glutamine methyltransferase that modifies peptide release factors
locus
BSU37000
pI
4.89
mw
32.23 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
function
peptide release factor methylation
product
N5-glutamine methyltransferase
essential
no
ec
2.1.1.297
synonyms
hemK, ywkE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.13|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.8|Protein modification/ other]
  • Gene

    Coordinates
    3,796,217 → 3,797,083

    Phenotypes of a mutant

  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • hemK family (according to Swiss-Prot)
  • Structure

  • [PDB|1NV8] (the protein from ''Thermotoga maritima'') [Pubmed|12741815]
  • Expression and Regulation

    Operons

    genes
    [gene|59E6468FD891F5271F38543515867B0B4625768D|prfA]-[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]-[gene|B56B38A1CCC0A73FFD9F3F4C9942356E6D818D2D|yfkF]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A199 (ywkE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/199 NBRP B. subtilis, Japan]
  • BKE37000 (Δ[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGGCTTCGAATATCGTCT, downstream forward: _UP4_TAAGCAGCTTGCTGGCGAGT
  • BKK37000 (Δ[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGGCTTCGAATATCGTCT, downstream forward: _UP4_TAAGCAGCTTGCTGGCGAGT
  • References

  • 11805295,11847124,12741815,28189581