SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to N5-glutamine methyltransferase that modifies peptide release factors
32.23 kDa
protein length
288 aa Sequence Blast
gene length
867 bp Sequence Blast
peptide release factor methylation
N5-glutamine methyltransferase
hemK, ywkE

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.9|Newly identified competence genes]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other/ based on similarity]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein modification/ other]
  • Gene

    3,796,217 → 3,797,083

    Phenotypes of a mutant

  • non-transformable [pubmed|28189581]
  • The protein

    Protein family

  • protein N5-glutamine methyltransferase family (single member, according to UniProt)
  • Structure

  • [PDB|1NV8] (the protein from ''Thermotoga maritima'') [Pubmed|12741815]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A199 (ywkE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE37000 (Δ[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGGCTTCGAATATCGTCT, downstream forward: _UP4_TAAGCAGCTTGCTGGCGAGT
  • BKK37000 (Δ[gene|CF959D90A9B8F83E40E7B81CBFB00B5EC09EC0DD|prmC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGGGCTTCGAATATCGTCT, downstream forward: _UP4_TAAGCAGCTTGCTGGCGAGT
  • References

  • 11805295,11847124,12741815,28189581