SubtiBank SubtiBank
ptpZ
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ptpZ

phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]
locus
BSU_36240
pI
6.66
mw
28.81 kDa
protein length
254 aa Sequence Blast
gene length
765 bp Sequence Blast
function
protein tyrosine dephosphorylation
product
phosphotyrosine protein phosphatase, antagonist to [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA]
essential
no
ec
3.1.3.48
synonyms
ywqE

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.4|Regulation]
  • Gene

    Coordinates
    3,731,005 → 3,731,769

    The protein

    Catalyzed reaction/ biological activity

  • H2O + O-phospho-L-tyrosyl-[protein] --> L-tyrosyl-[protein] + phosphate (according to UniProt)
  • dephosphorylation of [protein|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|Ugd], [protein|DF8CD0B3997A7A4CF4821A7D64E9898422FD17E0|TuaD] and [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA] [Pubmed|15866923]
  • Protein family

  • [SW|Metallo-dependent hydrolases superfamily] (according to UniProt)
  • Structure

  • [PDB|3QY7] [Pubmed|21605684]
  • Expression and Regulation

    Operons

    genes
    [gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]-[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]-[gene|45AFD434F5262BFBE4ED6DF3D18DAED61FF317D1|ugd]
    description
    [Pubmed|20815827,12970183]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20815827], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|26283769], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P, [Pubmed|26283769], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A077 (ywqE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/77 NBRP B. subtilis, Japan]
  • GP1609 (spc), available in [SW| Jörg Stülke]'s lab
  • GP1610 (''[gene|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|ptkA]-[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]'', spc), available in [SW| Jörg Stülke]'s lab
  • BKE36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT, downstream forward: _UP4_TAACAGCCGATTCTCATTTC
  • BKK36240 (Δ[gene|CF73D86DB024575BE8F043A4C3996458F4262E46|ptpZ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCCTAGCCCCCTTTTT, downstream forward: _UP4_TAACAGCCGATTCTCATTTC
  • References

  • 15866923,12970183,21605684,20815827,21605684,20817675,26283769,27148221