SubtiBank SubtiBank
yhfS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfS

similar to acetyl-CoA C-acetyltransferase
locus
BSU_10350
pI
5.12
mw
38.24 kDa
protein length
364 aa Sequence Blast
gene length
1095 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,109,388 → 1,110,482

    The protein

    Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|07498A0A3CB598A6E388540124A4F56E781C86FA|FadA], [protein|226100C0AC13BB345DB0F0F309DEB7F91F3770B0|MmgA]
  • Structure

  • [PDB|4E1L] (from ''Clostridium Difficile'', 38% identity)
  • [PDB|3SS6] (the protein of ''B. anthracis'', 38% identity, 66% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|11717296], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    genes
    [gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B279 (yhfS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1278 NBRP B. subtilis, Japan]
  • BKE10350 (Δ[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTATACTGTACACT, downstream forward: _UP4_TAGGCTTTTTCATAGGACAC
  • BKK10350 (Δ[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCATTTATACTGTACACT, downstream forward: _UP4_TAGGCTTTTTCATAGGACAC
  • References

  • 22383849,12368242