SubtiBank SubtiBank
nudF
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

nudF

involved in isopentenol (isoprenoid) biosynthesis, has RNA pyrophosphohydrolase activity
locus
BSU_23610
pI
4.59
mw
20.84 kDa
protein length
185 aa Sequence Blast
gene length
558 bp Sequence Blast
function
isoprenoid biosynthesis
product
unknown
essential
no
ec
3.6.1.13
synonyms
yqkG

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.3|Biosynthesis of isoprenoids]
  • Gene

    Coordinates
    2,458,509 → 2,459,066

    The protein

    Catalyzed reaction/ biological activity

  • ADP-D-ribose + H2O --> AMP + D-ribose 5-phosphate + 2 H+ (according to UniProt)
  • Protein family

  • [SW|Nudix hydrolase] (according to UniProt)
  • [SW|Domains]

  • [SW|Nudix hydrolase domain] (aa 40-171) (according to UniProt)
  • Structure

  • [PDB|1V8I] (from ''Thermus thermophilus'', 38% identity) [Pubmed|15210687]
  • Expression and Regulation

    Operons

    genes
    [gene|CF38BE04F04919BB304789E9B3FE489385E468E6|nudF]-[gene|9D05B104000EED08FB62D6F362FC5E9C2A5354D9|yqxK]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C410 (yqkG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2408 NBRP B. subtilis, Japan]
  • BKE23610 (Δ[gene|CF38BE04F04919BB304789E9B3FE489385E468E6|nudF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCATCTCCCGTTC, downstream forward: _UP4_AAAGAAGCGCTCCAAGCACA
  • BKK23610 (Δ[gene|CF38BE04F04919BB304789E9B3FE489385E468E6|nudF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTCTTCATCTCCCGTTC, downstream forward: _UP4_AAAGAAGCGCTCCAAGCACA
  • References

  • 17693564,10542272,15210687,31740579