SubtiBank SubtiBank
yrzA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yrzA

unknown
locus
BSU_27290
pI
6.09
mw
7.50 kDa
protein length
gene length
204 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,788,680 → 2,788,883

    Expression and Regulation

    Operons

    genes
    [gene|CF34154433238B5C9C9A7A9A458EA4CF0A2D296E|yrzA]
    description
    [Pubmed|22383849]

    regulation

  • expressed during [SW|sporulation] [Pubmed|22383849]
  • view in new tab

    Biological materials

    Mutant

  • BKE27290 (Δ[gene|CF34154433238B5C9C9A7A9A458EA4CF0A2D296E|yrzA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGACCCTCCAGCT, downstream forward: _UP4_TAAAACAAAAGCAGCCGGTT
  • BKK27290 (Δ[gene|CF34154433238B5C9C9A7A9A458EA4CF0A2D296E|yrzA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTTGACCCTCCAGCT, downstream forward: _UP4_TAAAACAAAAGCAGCCGGTT