SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


developmental checkpoint protein, controls the phosphorylation status of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]
6.02 kDa
protein length
gene length
159 bp Sequence Blast
mediates a developmental checkpoint coupling initiation of [category|SW 4.2|Sporulation] (phosphorylation of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A])to the function of replication initiation proteins
developmental checkpoint protein

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW|Proteins controlling the activity of the kinases]
  • Gene

    2,647,456 → 2,647,614

    Phenotypes of a mutant

  • sporulates at a higher frequency
  • will sporulate in the presence of replication stress
  • The protein

    Catalyzed reaction/ biological activity

  • Sda is a checkpoint protein that is upregulated in response to replication stress [Pubmed|11207367]. Sda inhibits the autokinase activity of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|KinA] (and likely [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB] as well). This in its turn results in reduced levels of [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A~P]]]. Thus, replication stressed cells will not initiate sporulation.
  • Structure

  • [PDB|3D36] (from ''Geobacillus stearothermophilus'', complex with [protein|2111AC1AE49D1006E10DC127BF5B7A0327DE94A7|KinB]) [Pubmed|19101565], [PDB|1PV0]
  • Additional information

  • [protein|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|Sda] is rapidly degraded by the [protein|CB06A70DE7462CEB7AF5D8C28943C878DD56DE1A|ClpP/X]]] system because of some uncharged residues at its C-terminus [Pubmed|16796683]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|11207367], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]: activation, under replication stress [Pubmed|17932079], in [regulon|6740108089F13116F200C15F35C2E7561E990FEB|DnaA regulon]
  • [protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA]: repression, [Pubmed|16267290], in [regulon|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|LexA regulon]
  • regulation

  • induced by DNA damage ([protein|search|LexA]) [Pubmed|16267290]
  • additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|sda]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • 1A1034 (no resistance), [Pubmed|16796683], available at [ BGSC]
  • BKE25690 (Δ[gene|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|sda]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGGGAGAGGCACCTCCTT, downstream forward: _UP4_TAATAGGAATTTGTCTATTT
  • BKK25690 (Δ[gene|CEFD10FAFA0DBC83CD2B61DAC9339FEE025B1611|sda]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATGGGAGAGGCACCTCCTT, downstream forward: _UP4_TAATAGGAATTTGTCTATTT
  • labs

  • [SW|Bill Burkholder] [ Homepage]
  • References


  • 22933559
  • Original publications

  • 11207367,16267290,19465772,15023339,16796683,19684115,17932079,17350039,19101565,20525796,26020636,28752667